This document explains how to design a pair of PCR primers for a gene to be expressed in S. cerevisiae. The example chosen is the S.cerevisiae XKS1 gene, but the general guidelines are applicable for any gene. We assume that the DNA sequence for the open reading frame of the gene is available. There are a number of important considerations, especially for heterologous genes.
Introns
Does your gene have introns? S. cerevisiae has a limited capacity to process introns. See A broad analysis of splicing regulation in yeast using a large library of synthetic introns by Schirman et al. 2021. We have successfully expressed the Yarrowia lipolytica ACC1 gene containing introns Pereira et al. 2022
Design primers automatically with the Primer designer tool of Pydnaweb.
Go to Pydnaweb and click in the “Primer designer” button. Replace the default sequence with your sequence, be sure to use use proper FASTA or GenBank format. In this example, the gene for S. cerevisiae xylulokinase XKS1/YGR194C is used as an example below.

Click the submit button and copy the primers to your electronic lab book.

The next step is to consider modifications to the primers in order to maximize expression level of the gene. This might involve:
- adding a stabilizing amino acid codon between the start codon and the first amino acid codon.
- adding an efficient Kozak sequence
>f1803 21-mer
ATGTTGTGTTCAGTAATTCAG
|||
LEU
The N-end rule
The first amino acid in the protein in Saccharomyces cerevisiae is coded by the codon immediately after the start codon as the start codon is not translated. The first amino acid in the xylulokinase gene is Leucine which destabilizes the protein according to the N-end rule with a half-life of around 3 min. See this table for amino acid properties including stabilization and preferred codons in S. cerevisiae.
A stabilizing amino acid such as glycine would on the other hand give a half life of >30 h.
We can stabilize the protein by adding a stabilizing amino acid, such as glycine, before the first amino acid by modifying the forward primer. Glycine could be a good choice in most cases as it is small and not likely to affect protein function.
>f1803 21-mer
ATGggtTTGTGTTCAGTAATTCAG
gly
This modification of the forward primer means that is does no longer bind as intended as it not longer anneals perfectly on the 5’ side. We can design a new pair of primers using the Primer designer tool by removing the start codon.

>f1800 21-mer (new forward primer without start codon)
TTGTGTTCAGTAATTCAGAGA
>r1800 20-mer
TTAGATGAGAGTCTTTTCCA
We can see that the new forward primer ends three nucleotides downstream of the old one to compensate for the removal of the start codon. We then add back the start codon and the glycine codon:
>f1800
atgggtTTGTGTTCAGTAATTCAGAGA
>r1800
TTAGATGAGAGTCTTTTCCA
Kozak consensus sequence
The nucleotides immediately upstream of the start codon (kozak consensus sequence) affects protein translation efficiency in S. cerevisiae. Xu et al. 2021 found that K528 (tctgcaata) was the most efficient among the sequences tested.
>f1800
tctgcaataATGggtTTGTGTTCAGTAATTCAGAGA
|||||||||
--K528--- gly
sta
The primer above has the K528 Kozak sequence, a start codon and a glycine codon followed by the new primer sequence. The Pydnaweb WebPCR simulator confirms the annealing of the primers (below) and also provides a suitable PCR program for two kinds of DNA polymerases (not shown).
5TTGTGTTCAGTAATTCAGAGA...TGGAAAAGACTCTCATCTAA3
||||||||||||||||||||
3ACCTTTTCTGAGAGTAGATT5
5tctgcaataATGggtTTGTGTTCAGTAATTCAGAGA3
|||||||||||||||||||||
3AACACAAGTCATTAAGTCTCT...ACCTTTTCTGAGAGTAGATT5
Tails for recombination in the Yeast Pathway Kit system
Genes can be cloned by gap repair in the Yeast Pathway Kit system instead of cloning into pYPKa. The primer tails below provide the PCR product with flanking homology to the promoter and terminator.
<-- Forward tail 28 nt ---->
actttctcactagtgacctgcagccGAC-(Kozak)-ATG...
---
sta
<-- Reverse tail 28 nt ---->
ctgatgcgtttgtctgcacagatggCAC...???
---
stp
In our case the final primers will be (### = start, stop codons):
actttctcactagtgacctgcagccGAC-tctgcaata-ATGggtTTG........
--------- tail-------------- kozakk... ###lys
ctgatgcgtttgtctgcacagatggCAC-TTAGATGAGAGTCTTTTCCA.......
--------- tail-------------- ###