Plasmid miniprep with commercial kit & restriction digestion

material > LAB10

Summary:

  • cut DNA with restriction enzymes, one enzyme per group.
  • Plasmid miniprep using a commercial kit for DNA sequencing.
  • Run agarose gel#5 on plasmid DNA and digested plasmid DNA
Table#6GroupEnzyme mix
1AjiI
4EcoRI
3EcoRV(Eco32I)

Enzyme mix = 5 µL Enzyme + 5 µL buffer x10

Restriction digestion (One per group)

  • Pipette 8 µL of the plasmid solution into a new Eppendorf tube.
  • Mark the Eppendorf tube
  • Ask your teacher to add 2 µL of Restriction enzyme mix (Table#6) to your tube.
  • Spin and incubate for one hour at 37°C. During this incubation, do the plasmid preparation below.

Miniprep, one per group

Preparation of plasmids using a commercial alkaline lysis mini prep kit. The teacher has prepared E. coli cultures in liquid medium beforehand. Cultures with each plasmid were grown in or on LB with antibiotics for selection of the plasmids. We will use the NZYMiniprep.

Agarose gel electrophoresis of plasmid DNA and plasmid digestion

  • Put a 2 µL drop of 6x DNA loading buffer on a piece of Parafilm.
  • Add 6 µL of plasmid DNA to the drop
  • Put the gel in the gel tray.
  • Add more buffer (if needed) until the gel is just submerged.
  • Add all of the DNA to an empty well, start with the leftmost well.
  • Take note of where your samples are.
  • The teacher will load the molecular weight marker.
  • Apply the electrical field as soon as you are done.
  • The electrophoresis last around 15 - 20 min.
  • When the gel run is completed, the teacher with take a picture using a transilluminator.

📌Sample📝µL😶
GeneRuler 1 kb ladder3
pTA7 candidateα6👽
✂️ AjiIAjiI”
✂️ EcoRIEcoRI”
✂️ Eco32IEco32I”
pTA7 candidateβ”🥳
✂️ AjiIAjiI”
✂️ EcoRIEcoRI”
✂️ Eco32IEco32I”
pTA7 candidate∆”🥳
✂️ AjiIAjiI”
✂️ EcoRIEcoRI”
✂️ Eco32IEco32I”
pTA7 candidateε”🥳
✂️ AjiIAjiI”
✂️ EcoRIEcoRI”
✂️ Eco32IEco32I”
GeneRuler 1 kb ladder3
NZYMiniprepα
""β
""∆
""ε

Gel: NZYMiniprep, elution 50 µL warm AE buffer.

Theoretical plasmid assembled by students on LAB5

Annotated nanopore whole plasmid sequencing result



TAAAATCTCGTAAAGGAACTGTCTGCTCTG s3



TAAAATCTCGTAAAGGAACTGTCTGCTCTGtataaaaataggcgtatcacg 1804_TRP1fp_pTA replaces 1348 & 1680
                              --------------------- YEplac112 YCplac22 YIplac204


               GAACTGTCTGCTCTGttcaagaattaattcggtcg  1680_TRP1fp_pTA New TRP1 primer, partial s3, replaces 1348, replaced by 1804
                                        ----------  YXplacs snapgene


TAAAATCTCGTAAAGGAACTGTCTGCTCTGtttgccgattaagaattcg   1348_TRP1fp_pTA  This primer was replaced by 1680
                              -------------------   TRP1 SGD
                                           ------   YXplacs snapgene


tataaaaataggcgtatcacgaggccctttcgtcttcaagaattaattcggtcgaaaaaagaaaaggagagggccaagagggagggcattggtgactattgagcacgtgagtatacgtgattaagcacacaaaggcagcttggagtatg TRP1 YEplac112 YCplac22
--------------------- 1804        -------------------- 1680
                                            ------     1348

tataaaaataggcgtatcacgaggccxxxxxxxxxxxxxxxxxxaattcggtcgaaaaaagaaaaggagagggccaagagggagggcattggtgactattgagcacgtgagtatacgtgattaagcacacaaaggcagcttggagtatg TRP1 YIplac204
--------------------- 1804                  ---------- 1680
                                            ------     1348

                               TTTGCCGATTAAGaattcggtcgaaaaaagaaaaggagagggccaagagggagggcattggtgactattgagcacgtgagtatacgtgattaagcacacaaaggcagcttggagtATG TRP1 SGD
                               ------------------- 1348

The YEplac112, YCplac22 and YIplac204 vectors all express the TRP1 gene. The sequences for these vectors are available from both Genbank and Snapgene
(see pTAx assembly strategy).

A peculiarity is that the YIplac204 TRP1 promoter seems to have an 18 bp deletion (marked by xxxxxxxxxxxxxxxxxx) compared to the sequences in YEplac112 YCplac22.