2x PCR mastermix
Using a PCR master-mix saves time and improves PCR reproducibility, especially if many reactions are prepared. For a standard PCR reaction, half of the final volume should be used, for example 25 µL 2x PCR mastermix for a 50 µL PCR reaction. Scale up or down as needed.
| Component | µL | stock | 2xPCR mastermix | final concentration in PCR reaction |
|---|---|---|---|---|
| Water | 16 | - | - | - |
| Buffer(xC) | 5 | 10x | 2x | 1x |
| MgCl2(mM) | 2 | 50 mM | 4 mM | 2 mM |
| dNTPs(mM) | 1 | 10 | 0.4 | 0.2 |
| Taq | 1 | 100% | 5.0% | 2.5% |
| Total | 25 | - | - | - |
1.5x Green PCR mastermix (mastermix with PCR compatible loading buffer)
The 2xPCR mastermix can be combined with a PCR compatible loading buffer such as the in described in the table below. This saves time if you have many samples as they can be loaded directly on a gel. Use 33 µL of the 1.5x Green PCR mastermix for a 50 µL PCR reaction. Scale up or down as needed.
| Component | µL |
|---|---|
| 2x PCR mastermix | 25 |
| 6 x DNA loading buffer (PCR compatible) | 8 |
| Total | 33 |
For MEC lab members:
This google sheet contains the recipe above. Create a new tab named after the date of preparation in ISO 8601 format. Copy paste an old recipe and modify if necessary.
Testing
Since we make our own master mix, we need a standardized test mix. Primers 18 and 19 amplify a 1288 bp PCR product from the DFR1 locus in S. cerevisiae. This PCR reaction is very robust and gives a high yield. We use the following mix where final primer concentration is 0.5 µM:
- 78 µL H2O
- 10 µL Primer (10 µM)
19_D-DFR1 GACTCAGACAGGTTGAAAAGAAGAC - 10 µL Primer (10 µM)
18_A-DFR1 CAAAGGTTTGGTTTTCAGTTAAGAA - 2 µL Chromosomal DNA from S. cerevisiae
Add 5 µL of the test mix to 5 µL of 2x master mix and run the PCR program below: Source
Taq (rate 30 nt/s) 35 cycles |1288 bp
95.0°C |95.0°C | |
|_________|_____ 72.0°C |72.0°C|
| 03min00s|30s \ ________|______|
| | \ 55.0°C/ 40s | 5min |
| | \_____/ | |
| | 30s | |