2x PCR mastermix
Using a PCR master-mix saves time and improves PCR reproducibility, especially if many reactions are prepared. For a standard PCR reaction, half of the final volume should be used, for example 25 µL 2x PCR mastermix for a 50 µL PCR reaction. Scale up or down as needed.
| Component | µL | stock | 2xPCR mastermix | final concentration in PCR reaction |
|---|---|---|---|---|
| Water | 16 | - | - | - |
| Buffer(xC) | 5 | 10x | 2x | 1x |
| MgCl2(mM) | 2 | 50 mM | 4 mM | 2 mM |
| dNTPs(mM) | 1 | 10 | 0.4 | 0.2 |
| Taq | 1 | 100% | 5.0% | 2.5% |
| Total | 25 | - | - | - |
1.5x Green PCR mastermix (mastermix with PCR compatible loading buffer)
The 2xPCR mastermix can be combined with a PCR compatible loading buffer such as the in described in the table below. This saves time if you have many samples as they can be loaded directly on a gel. Use 33 µL of the 1.5x Green PCR mastermix for a 50 µL PCR reaction. Scale up or down as needed.
| Component | µL |
|---|---|
| 2x PCR mastermix | 25 |
| 6 x DNA loading buffer (PCR compatible) | 8 |
| Total | 33 |
For MEC lab members:
This google sheet contains the recipe above. Create a new tab named after the date of preparation in ISO 8601 format. Copy paste an old recipe and modify if necessary.
Testing
Since we make our own mastermix, we need a standardized test. We use the following mix:
- 78 µL H2O
- 10 µL Primer 19
- 10 µL Primer 18
- 2 µL Chromosomal DNA from yeas
The primers amplify a 1288 bp PCR product from the DFR1 locus in S. cerevisiae using this program consisting of initial denaturation for 4 min at 94 °C, followed by 30 cycles of 94 °C for 30s, 50 °C for 30s, and 72 °C for 45 s, and a final extension at 72 °C for 5 min. Source
| 94.0°C |94.0°C | |
|_________|_____ 72.0°C |72.0°C|
| 04min00s|30s \ ________|______|
| | \ 50.0°C/ 0min45s| 5min |
| | \_____/ | |
| | 30s | |
This PCR reaction is very robust and gives a high yield.
Primers
- 19_D-DFR1 GACTCAGACAGGTTGAAAAGAAGAC
- 18_A-DFR1 CAAAGGTTTGGTTTTCAGTTAAGAA