# Purifying and testing recombinant Taq DNA polymerase
This protocol was adapted from the one described in Protzko RJ, Erickson FL. Research Article: A scaled-down and simplified protocol for purifying recombinant Taq DNA polymerase. BIOS journal 2012;83:8–11.

  1. Streak an E. coli strain with a Taq expression plasmid on solid lysogeny broth (LB) with 100 µg/mL ampicillin (LB-amp) and incubate at 37°C at least four days before the experiment.
  2. Inoculate ~5 mL liquid LB-amp medium in a test tube with one isolated colony from the plate.
  3. The day before, Inoculate 30-50 mL of liquid LB-amp with 1 mL of saturated culture.
  4. Grow culture at 37°C with shaking at 200 rpm until cloudy (A600 = 0.4-1.0).
  5. Induce expression of Taq DNA polymerase I gene by adding IPTG to 0.2 mM.
  6. Grow culture overnight for an additional 10-16 hours.
  7. Dispense 1 mL of induced bacterial culture into a 1.5 mL microfuge tube.
  8. Pellet cells by spinning for 30s at maximum speed using a microcentrifuge.
  9. Decant supernatant and remove all trace of media with a pipette.
  10. Add 200 µL TEN buffer to the cells
  11. Completely resuspend cell pellet with a pipette without creating excessive frothing.
  12. Heat resuspended cells at 75°C for 30 min in a water bath, with brief mixing every 10 min.
  13. Centrifuge for 10 min at maximum speed in micro-centrifuge to pellet cell debris.
  14. Transfer supernatant containing recombinant Taq DNA polymerase to a fresh tube.
  15. Discard the tube with the cell pelle
  16. Mark the tube with the supernatant “Taq” and your group number.
  17. Put the tube on ice for later use.

Prepare 2x mastermix (2xmm) for PCR

  1. Add 25 µL of the 4x dNTP mix (4x dNTP) to a fresh 1.5 mL eppendorf tube.
  2. Add 8 µL of the Taq preparation from the “Taq” tube
  3. Add 17 µL of ultrapure water to the tube
  4. Mix by slowly pipetting up and down 1-3 times.
  5. Put the tube on ice and mark it “2xmm”

Prepare a PCR reaction

  1. Place two 200µL PCR tubes in a rack and mark one of them “+” and the other one “-”
  2. Add 10 µL of the 2x mastermix (2xmm) to each of the PCR tubes.
  3. Add 10 µL of the 2x Primer mix (2xP) to the “-” tube and close the tube.
  4. Add 10 µL of the 2x Primer+template mix (2xPT) to the “+” tube and close the tube.
  5. Put both tubes on ice.

Prepare an agarose gel

If you have an agarose gel, skip this section entirely. If you have already a gel in a Erlenmeyer flask, skip steps 1-3 and heat the gel until completely liquid.

  1. Weigh up 0.5 g agarose in a piece of paper or aluminium foil
  2. Add 50 mL of TAE or TBE buffer in a 100 mL Erlenmeyer flask
  3. Add the agarose to the buffer and swirl the flask to mix
  4. Run the flask for 30s in a microwave oven
  5. Swirl the flask to mix and return to 4 if you can see undissolved agarose
  6. Let cool until you can hold the flask in your hand. Continue to step 7.
  7. Seal a gel tray with masking tape
  8. pour the liquid gel in the tray
  9. put a gel comb in place
  10. Wait until the gel is solid, remove the gel and put it in an airtight container with enough buffer to cover and store the gel until needed.

Material needed for all groups:

  • 1x Micro-centrifuge
  • 1x 75°C water bath
  • 50 mL TEN buffer
  • PCR tubes
  • Agarose

TEN buffer

  • 10 mM Tris-HCl pH 7.9
  • 1 mM EDTA
  • 100 mM NaCl

4x dNTP mix (4x dNTP)

  • 500 µL Taq buffer (10x) w Ammonium sulphate
  • 200 µL MgCl2 (50 mM)
  • 100 µL dNTPs (10 mM)
  • 450 µL ultrapure water

2x Primer+template mix (2xPT)

  • 470 µL ultrapure water
  • 10 µL Primer 19 (100 µM)
  • 10 µL Primer 18 (100 µM)
  • 10 µL Saccharomyces cerevisiae chromosomal DNA

2x Primer mix (2xP)

  • 480 µL ultrapure water
  • 10 µL Primer 19 (100µM)
  • 10 µL Primer 18 (100µM)

Primers

  • 19_D-DFR1 GACTCAGACAGGTTGAAAAGAAGAC
  • 18_A-DFR1 CAAAGGTTTGGTTTTCAGTTAAGAA

Material needed per group (5 groups):

  • Pipette P200.
  • Pipette P20.
  • Yellow tips (new, not necessarily sterile).
  • Rack for Eppendorf tubes.
  • Rack for PCR tubes.
  • Ice box.
  • floating tube rack for 1.5 mL tubes.