In-vivo assembly of pTA cloning vectors in Saccharomyces cerevisiae

The MEC group has developed a protocol
for the assembly of reasonably large metabolic pathways in-vivo.
This method is called the Yeast Pathway Kit.

In the last stages of pathway assembly, transcriptional units (promoter-gene-terminator)
are assembled together by in-vivo homologous recombination.

The first and last gene cassette is recombined with a plasmid that has genes necessary for
selection and maintenance of the pathway in yeast or E. coli.

In our original publication, a plasmid called pYPKpw was used. The pYPKpw had the following
features:

  • amp (ampicillin selection marker for E. coli)
  • pUC (high copy number origin of replication for E. coli)
  • 2µ (high copy number origin of replication for S. cerevisiae)
  • URA3 (selection marker for for S. cerevisiae
  • ΔCRP (a partial, inactive E. coli cyclic AMP receptor protein gene)

The CRP gene is inactive and only provide specific sequences for recombination.

The pTA1 plasmid was later made with a LEU2 selection marker.

It would be of interest to expand the range of plasmids for pathways, specifically:

  1. Having more selection marker for for S. cerevisiae would make it possible to combine several
    genes or pathways in the same cell.
  2. The 2µ ori gives a relatively high copy number of the vector. Having
    lower copy number would make it possible to fine tune gene expression
  3. The pUC origin of replication results in a high copy number of the vector in E. coli. This
    may lead to genetic instability in E. coli.
  4. Making vectors out of standardized parts would make it possible to make new vectors simply by exchanging one part.

primer design for pTA1

We chose to build the pTA1 plasmid from five genetic parts:

For the pTA1, five PCR products were made with PCR primers that
incorporate flanking sequences (s1 - s5) on each PCR product.
These flanking sequences can promote homologous recombination between the
fragments.

PCR productTemplateLeft sideRight side
amppBR322s5s1
pBRpBR322s1s2
LEU2YEplac181s2s3
2µYEplac112s3s4
ΔCRPpYPKpws4s5

The actual sequences of s1 - s5 were 30 bp sequences designed
with the R2oDNA designer tool:

DesignationSequence
s1AATCCAATCAGCGTAAGGTGTAGACTTTCT
s2ATCGTATCTGCTGCGTAAATAGTAGTCAAC
s3TAAAATCTCGTAAAGGAACTGTCTGCTCTG
s4AACTGTAAAATCAGGTATCTCGTAGTCCGT
s5GAAAAGCGTTTACCTCGGAACTCTATTGTA

The vector is assembled by homologous recombination between the s1-s5 sequences.

         s1
 -|amp|30
|      \/
|      /\       s2
|      30|pbr|30
|             \/
|             /\       s3
|             30|2µ|30
|                   \/
|                   /\       s4
|                   30|leu|30
|                          \/
|                          /\       s5
|                          30|ΔCRP|30
|                                  \/
|                                  /\
|                                  30-
|                                     |
 -------------------------------------

pTA3 and pTA4

Two new vectors are planned according to the table below:

Nameec_markerec_orisc_orisc_markerrec
pTA3amppBR2µHIS3ΔCRP
pTA4amppBRCEN/ARSHIS3ΔCRP

Most fragments are similar to the pTA1 except for new primers for the HIS3 marker
and the CEN/ARS yeast origin of replication.

More details https://docs.google.com/spreadsheets/d/1QRW1G7DU0yBL3jH7aHovJDFphXHLjtalRAbq6ytUw2g/edit#gid=1150891082


Class 1 Thursday May 13

Students have two main tasks:

  • each student will make a plasmid DNA preparation by the alkaline lysis method.
  • each student will prepare two PCR reactions.
  • each group will make an agarose gel for analysis of DNA.

Plasmid preparation

Follow this protocol: Plasmid preparation

Agarose gel electrophoresis of DNA

Each student should analyze their plasmid DNA using gel electrophoresis

  • Unfreeze the plasmid DNA if this was not already done.
  • Add 17 µL of water to an Eppendorf tube
  • Add 5 µL 6xloading buffer LBx6.
  • Add 8 µL plasmid DNA.
  • If necessary, spin the tube for ~2 seconds to collect the liquid at the bottom.
  • Put the gel in the electrophoresis chamber.
  • Add buffer until the gel is just submerged.
  • Add 10 µL of the mixture
  • Apply the electrical field as soon as you are done.
  • The electrophoresis last around 15 - 30 min at 100 volts in the Bio Rad Mini Sub Cell.

Post stain

  • Put the gel in TAE + Midori, incubate 15-30 min
  • Take picture

Dilution of plasmid DNA (x 500)

We need to dilute the plasmid in water in order to prepare a PCR reaction.

  1. Pipette 1 mL ultra-pure water into a fresh Eppendorf tube.
  2. Mark this tube well so that you can identify it.
  3. Vortex the tube with plasmid DNA so that you are sure that all DNA is dissolved.
  4. Transfer 2 µL of the plasmid DNA to the tube with 1 mL water This will make a 2µL/1000µL = x 500 dilution.
  5. Vortex the tube with the x 500 plasmid dilution so that the content is well mixed.
  6. Put the undiluted plasmid DNA in the -20°C freezer.

Preparation of a PCR reaction.

All PCR components need to be on ice at all times. Each student should prepare two PCR reactions. One reaction to amplify a plasmid part and one negative control. The difference between the amplification and control is that the control has a smaller volume and no template DNA. Each group has an ice box with each of the four ingredients for PCR. Pipette very carefully, there is only a limited amount of reagents.

Put two PCR tubes on ice to cool down. Add the reagents in the order given below.

PCR control (20 µL):

  • 10 µL MM2 (green)
  • 2 µL primer 1 (10 µM)
  • 2 µL primer 2 (10 µM)
  • 6 µL ultra-pure water

PCR amplification (40 µL):

  • 20 µL MM2 (green)
  • 4 µL primer 1 (10 µM)
  • 4 µL primer 2 (10 µM)
  • 12 µL diluted plasmid (x 500)

Keep all tubes on ice at all time.

The MM2 solution contain 2x concentrated PCR master mix and 6x
concentrated DNA loading buffer. This mixture contain all components needed
for PCR except primers and template. It also contain coloring and ficoll that
makes it easier to load the sample on a gel for analysis. The coloring and ficoll are
compatible with the PCR reaction. When you have prepared the tubes as described above,
leave them on ice.


Material

2 dias antes da aula:

  • LB com ampicilina (100 µg/mL) ~ 100 mL
  • 5 erlenmeyers (100 mL) estéreis

No dia da aula:

  • Pipetas P1000, P100, P20 e P10

  • Espátulas para pesar agarose

  • 4 caixas de esferovite para gelo

  • Tips amarelas (novos!)

  • Tips azuis (novos!)

  • 12 tubos Eppendorf com 1 mL tampão P1 (marcados “P1”)

  • 12 tubos Eppendorf com 1 mL tampão P2 (—”— “P2”)

  • 12 tubos Eppendorf com 1 mL tampão P3 (—”— “P3”)

  • 12 tubos com 1 mL TE x1

  • 4 tubos Falcon 50 mL (usados)

  • 4 suportes para tubos Eppendorf

  • 4 suportes para tubos Falcon 50 mL

  • 4 tubos Falcon 50 mL com 25-50 mL EtOH 96-100% (etanol absoluto para DNA/RNA)

  • 4 tubos Falcon 50 mL com 25-50 mL EtOH 70% (v/v) (Feito com agua ultrapura)

  • 4 copos com Tubos eppendorf 1.5 mL (novos, mas não necessariamente estéreis)

  • microcentrífuga

  • Agarose para géis

  • Tampão TAE x1

  • Tampão TAE stock

  • 4 copos de 50-100 mL

  • 1 proveta 50-100 mL

  • 4 erlenmeyers 250 mL

  • 2 tinas de eletroforese

  • Fonte de eletricidade

  • Barquinhos de pesagem (plástico)


Class 2 2021-05-20

This class has two main objectives:

  • yeast transformation.
  • agarose gel electrophoresis of PCR products.

Agarose gel electrophoresis of DNA

  • Each student is assigned a PCR tube according to the matrix is the Google spreadsheet.
  • Load the gel with 3 µL of the content of the PCR tube.
  • Wait for the teacher to load the molecular weight marker.
  • Apply the electrical field as soon as you are done.
  • The electrophoresis last around 15 - 20 min at 100 volts in the Bio Rad Mini Sub Cell.

Preparation of DNA mix

  • Add together the content of all PCR tubes with a number marked in bold in the Google spreadsheet.
  • Give the tube to the teacher.

Yeast transformation

Each student should make one transformation and each group should make one control transformation.
The control is specified in the google spreadsheet above.

  1. Transfer 1.5 mL ultra-pure water to an empty Eppendorf tube and put the tube on ice (cold water is needed later in the protocol)
  2. Put one 1.5 mL Eppendorf tube for each student on ice and one extra for the control transformation (eg. 4 tubes for a group with 3 members).
  3. Transfer 100 µL of the cell suspension to the tubes that you put on ice in the previous step. Keep the tubes on ice from now on when you are not pipetting.
  4. Spin the cells for 30 s at the highest speed.
  5. Remove supernatant with a P200 pipette. Leave the cell pellet at the bottom of the tube.
  6. Add 300 µL PLS to each cell pellet. This solution is viscous, so pipette slowly Keep tube on ice.
  7. Add 60 µL of the DNA mix or water (negative control) or the plasmid specified as positive control.
  8. To the control tube, add 60 µL of water or the specified positive control.
  9. Vortex the tubes until the cells are well mixed.
  10. Put the tubes in a floating tube rack at 42°C
  11. Incubate for 40 min.
  12. Remove tubes and put on ice for ~2 min.
  13. Add about 1/2 mL glass spheres to a to a Petri dish with the appropriate solid medium for selection (One plate per transformation).
  14. Spin tubes for 1 min at highest speed.
  15. Remove supernatant with a P1000 pipette. Leave the cell pellet at the bottom of the tube.
  16. Add 200 µL cold water (from the tube on ice, step 2) and resuspend with the pipette.
  17. Transfer 200 µL of the cell suspension to the Petri dish with the solid medium
  18. Spread the cells by shaking (The samba method!).

Post stain

  • Put the gel in TAE + Midori, incubate 15-30 min
  • Take picture

Material

  • 40 placas petri com meio SD+URA
  • banho 42°C
  • 4 barcos para tubos eppendorf
  • Pipetas P1000, P100, P20 e P10
  • Pontas amarelas, azuis e brancas estéreis
  • Tubos Eppendorf novos
  • ~500 ml de TAE buffer 1x
  • 2 sistemas de electroforese
  • 4 caixas de esferovite para gelo
  • esferas de vidro estereis ~5 mm (LGM)
  • 4 * 100 mL Agua ultrapura estéril
  • Espátula para pesar agarose
  • Agarose
NameSequence
1352_HIS3fp_pTATAAAATCTCGTAAAGGAACTGTCTGCTCTGAACACAGTCCTTTCC
1351_HIS3rp_pTAACGGACTACGAGATACCTGATTTTACAGTTTTTTTTCTCGAGTTCAAGA
1350_KanMX4fp_pTATAAAATCTCGTAAAGGAACTGTCTGCTCTGGACATGGAGGCCC
1349_KanMX4rp_pTAACGGACTACGAGATACCTGATTTTACAGTTCAGTATAGCGACCAGC
1348_TRP1fp_pTATAAAATCTCGTAAAGGAACTGTCTGCTCTGTTTGCCGATTAAGAATTCG
1347_TRP1rp_pTAACGGACTACGAGATACCTGATTTTACAGTTGATCTTTTATGCTTGCTTTTC
1346_URA3fp_pTATAAAATCTCGTAAAGGAACTGTCTGCTCTGGATTCCGGTTTCTTTGAAA
1345_URA3rp_pTAACGGACTACGAGATACCTGATTTTACAGTTGGTAATAACTGATATAATTAAATTGAA
1344_CEN_ARSfp_pTAATCGTATCTGCTGCGTAAATAGTAGTCAACACGGATCGCTTGC
1343_CEN_ARSrp_pTACAGAGCAGACAGTTCCTTTACGAGATTTTACTTTTCATCACGTGCTATA
1113_Amp.fw.nwGAAAAGCGTTTACCTCGGAACTCTATTGTAGAACCCCTATTTGTTTATTTTTCTA
987_Amp.REVAGAAAGTCTACACCTTACGCTGATTGGATTTGAAGTTTTAAATCAATCTAAA
1195_Pbr.REVGTTGACTACTATTTACGCAGCAGATACGATCTCGTTTCATCGGT
1196_Pbr.FWAATCCAATCAGCGTAAGGTGTAGACTTTCTCTGTCAGACCAAGTTTACT
977_Crp.REVTACAATAGAGTTCCGAGGTAAACGCTTTTCGTTCTTGTCTCATTGCC
978_Crp.FWAACTGTAAAATCAGGTATCTCGTAGTCCGTGTTCTGATCCTCGAGC
983_Micron.REVCAGAGCAGACAGTTCCTTTACGAGATTTTAGATCCAATATCAAAGGAA
984_Micron.FWATCGTATCTGCTGCGTAAATAGTAGTCAACGATCGTACTTGTTACCCAT
577_crp585-557gttctgatcctcgagcatcttaagaattc